rat cxcl 1  (Elabscience Biotechnology)

Journal: Nanomaterials

Article Title: In Vitro and In Vivo Assessment of PEGylated PEI for Anti-IL-8/CxCL-1 siRNA Delivery to the Lungs

doi: 10.3390/nano10071248

Figure Lengend Snippet: CXCL-1 ( A ) gene and ( B ) protein expression in lipopolysaccharide (LPS)-stimulated rat lungs. Animals were intra-tracheally administered 75 µg of non-targeting (NT) siRNA or anti-CXCL-1 siRNA (N/P = 7) 21 h prior to stimulating with 200 µg of LPS. Animals were euthanised 3 h post-LPS stimulation. CXCL-1 expression was normalised to the β-actin control gene expression (Kruskal–Wallis test and Dunn’s post-hoc test, * p < 0.05, min of n = 3 ± SD).

Article Snippet: The siRNA sequences for rat CXCL-1 (5′ UAACGAGAUAUUUAACGCCCCC 3′) were obtained from (Riboxx GmbH, Radebeul, Germany), and the siGENOME non-targeting siRNA #2 (5′ UAAGGCUAUGAAGAGAUAC 3′) scrambled sequence controls were obtained from Dharmacon (now Horizon Discovery, Cambridge, UK).

Techniques: Expressing

Journal: Nanomaterials

Article Title: In Vitro and In Vivo Assessment of PEGylated PEI for Anti-IL-8/CxCL-1 siRNA Delivery to the Lungs

doi: 10.3390/nano10071248

Figure Lengend Snippet: ( A ) Total cell population per mL of bronchoalveolar lavage (BAL) from the hemocytometer quantification ( B ) Macrophage population quantification from BAL image analysis (5 fields/animal) and representative images for each group including ( C ) PBS-PBS, ( D ) PBS-LPS, ( E ) PEI NT siRNA nanoparticle, ( F ) PEI CXCL-1 siRNA nanoparticle, ( G ) PEI-LPEG NT siRNA nanoparticle and ( H ) PEI-LPEG CXCL-1 siRNA nanoparticle-treated rats 24 h post-transfection. Images taken at 100× magnification (Kruskal–Wallis test and Dunn’s post-hoc test, * p < 0.05, *** p < 0.001, min of n = 3 ± SD).

Article Snippet: The siRNA sequences for rat CXCL-1 (5′ UAACGAGAUAUUUAACGCCCCC 3′) were obtained from (Riboxx GmbH, Radebeul, Germany), and the siGENOME non-targeting siRNA #2 (5′ UAAGGCUAUGAAGAGAUAC 3′) scrambled sequence controls were obtained from Dharmacon (now Horizon Discovery, Cambridge, UK).

Techniques: Transfection